pMEL14
(Plasmid
#107920)
-
PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacer
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107920 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonep426-SNR52p-gRNA.CAN1.Y-SUP4t
-
Backbone manufacturerGeorge Church (Addgene plasmid # 43803)
- Backbone size w/o insert (bp) 6945
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA-CAN1.Y
-
gRNA/shRNA sequenceGATACGTTCTCTATGGAGGA
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)20
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMEL14 was a gift from Jean-Marc Daran (Addgene plasmid # 107920 ; http://n2t.net/addgene:107920 ; RRID:Addgene_107920) -
For your References section:
CRISPR/Cas9: a molecular Swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae. Mans R, van Rossum HM, Wijsman M, Backx A, Kuijpers NG, van den Broek M, Daran-Lapujade P, Pronk JT, van Maris AJ, Daran JM. FEMS Yeast Res. 2015 Mar;15(2). pii: fov004. doi: 10.1093/femsyr/fov004. Epub 2015 Mar 4. 10.1093/femsyr/fov004 PubMed 25743786