Lifeact-rsLOV1 pcDNA3.1(+)
(Plasmid
#107881)
-
PurposeMammalian expression of Lifeact-rsLOV1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107881 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5374
- Total vector size (bp) 5875
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namersLOV1
-
SpeciesSynthetic
-
Insert Size (bp)429
- Promoter CMV
-
Tag
/ Fusion Protein
- Lifeact (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lifeact-rsLOV1 pcDNA3.1(+) was a gift from Stefan Hell (Addgene plasmid # 107881 ; http://n2t.net/addgene:107881 ; RRID:Addgene_107881) -
For your References section:
Novel reversibly switchable fluorescent proteins for RESOLFT and STED nanoscopy engineered from the bacterial photoreceptor YtvA. Gregor C, Sidenstein SC, Andresen M, Sahl SJ, Danzl JG, Hell SW. Sci Rep. 2018 Feb 9;8(1):2724. doi: 10.1038/s41598-018-19947-1. 10.1038/s41598-018-19947-1 [pii] PubMed 29426833