Skip to main content
Addgene

ilux pQE(-)
(Plasmid #107880)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107880 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQE(-)
  • Backbone size w/o insert (bp) 3428
  • Total vector size (bp) 10033
  • Modifications to backbone
    His-deleted version of pQE30
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ilux
  • Species
    Synthetic
  • Insert Size (bp)
    6605
  • Promoter T5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XmaI (not destroyed)
  • 5′ sequencing primer CGGATAACAATTTCACACAG
  • 3′ sequencing primer CGAGCGTTCTGAACAAATCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid may exhibit instability in the T5 promoter region. It is recommended to verify this region by Sanger sequencing with AmpSeq-F 5'-ctcatgagcggatacatatttgaa-3'.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ilux pQE(-) was a gift from Stefan Hell (Addgene plasmid # 107880)
  • For your References section:

    Strongly enhanced bacterial bioluminescence with the ilux operon for single-cell imaging. Gregor C, Gwosch KC, Sahl SJ, Hell SW. Proc Natl Acad Sci U S A. 2018 Jan 30;115(5):962-967. doi: 10.1073/pnas.1715946115. Epub 2018 Jan 16. 10.1073/pnas.1715946115 PubMed 29339494