Skip to main content
Addgene

pClodAcytCh-PIP2PHGFP
(Plasmid #107867)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107867 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pClodA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cherry and PLCδ-PH domain
  • Species
    Synthetic
  • Promoter pro D (dual)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgctgtgctctgcgaaagccagt
  • 3′ sequencing primer CACCTGACGTCTAAGAAACCAT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH, kindly provided the original plasmid with the PH domain of phospholipase Cδ1 (PLCδ-PH domain) which binds PIP2(42). see references in paper.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClodAcytCh-PIP2PHGFP was a gift from Sanford Simon (Addgene plasmid # 107867 ; http://n2t.net/addgene:107867 ; RRID:Addgene_107867)

  • For your References section:

    Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849
Related items: