Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p15aC-4D1D-5
(Plasmid #107866)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107866 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15aC
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PIS
  • Alt name
    phosphatidyl inositol synthase
  • Alt name
    phosphatidylinositol synthase
  • Alt name
    PI synthase
  • Species
    Trypanosome brucei
  • Promoter proD
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TATTTCTAGATTTCAGTGCA
  • 3′ sequencing primer AAGATACTCTCAACCACGTAGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    phosphatidylinositol 4-phosphate 5-kinase
  • Alt name
    phosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2
  • Alt name
    PI4P5Kα
  • Alt name
    PI4P5K
  • Species
    H. sapiens (human)
  • Promoter proD (in operon)
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATGTATCATCTGGCGGTTCT
  • 3′ sequencing primer TTACAACAGTACTGCGATGA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    phosphatidylinositol 4-kinase β
  • Alt name
    PI4K
  • Alt name
    phosphatidyl inositol 4-kinase β
  • Alt name
    PI4Kβ
  • Species
    Bos taurus
  • Promoter proD
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAATGCCTCAAAATGTTCTTTACGAT
  • 3′ sequencing primer CTCGCCGCAGTCGAACGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Trypanosome brucei phosphatidyl inositol synthase (PIS)(30) was kindly provided by Dr. Terry K. Smith of The University of St Andrews, UK. Human phosphatidylinositol 4-phosphate 5-kinase type-1 α isoform 2 (PI4P5Kα, PI4P5K)(51) was kindly provided by Dr. Richard A. Anderson of the University of Wisconsin - Madison. Bos taurus phosphatidylinositol 4-kinase β (PI4Kβ, PI4K)(52) was kindly provided by Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH. See references in paper

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p15aC-4D1D-5 was a gift from Sanford Simon (Addgene plasmid # 107866 ; http://n2t.net/addgene:107866 ; RRID:Addgene_107866)
  • For your References section:

    Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849