Skip to main content
Addgene

p15aC-4D1D
(Plasmid #107864)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107864 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15aC
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    PIS
  • Alt name
    phosphatidyl inositol synthase
  • Alt name
    phosphatidylinositol synthase
  • Alt name
    PI synthase
  • Species
    Trypanosome brucei
  • Promoter proD
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TATTTCTAGATTTCAGTGCA
  • 3′ sequencing primer TTACAACAGTACTGCGATGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    phosphatidylinositol 4-kinase β
  • Alt name
    PI4K
  • Alt name
    phosphatidyl inositol 4-kinase β
  • Alt name
    PI4Kβ
  • Species
    Bos taurus
  • Promoter proD
  • Tag / Fusion Protein
    • myc (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAAATGCCTCAAAATGTTCTTTACGAT
  • 3′ sequencing primer CTCGCCGCAGTCGAACGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Trypanosome brucei phosphatidyl inositol synthase (PIS)(30) was kindly provided by Dr. Terry K. Smith of The University of St Andrews, UK. Bos taurus phosphatidylinositol 4-kinase β (PI4Kβ, PI4K)(52) was kindly provided by Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH. See references in paper

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p15aC-4D1D was a gift from Sanford Simon (Addgene plasmid # 107864 ; http://n2t.net/addgene:107864 ; RRID:Addgene_107864)
  • For your References section:

    Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849