Skip to main content
Addgene

pSpCAS9n(BB)-2A-puro DNM1, B
(Plasmid #107796)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107796 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PX459, pSpCAS9n(BB)-2A-puro
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48139)
  • Backbone size w/o insert (bp) 9200
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting human DNM1
  • gRNA/shRNA sequence
    GAGTAGGGGCTGAATGCGGC
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    20

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bbsl1 (unknown if destroyed)
  • 3′ cloning site Bbsl1 (unknown if destroyed)
  • 5′ sequencing primer U6
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Created using DNA assembly in yeast

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCAS9n(BB)-2A-puro DNM1, B was a gift from Sandra Schmid (Addgene plasmid # 107796 ; http://n2t.net/addgene:107796 ; RRID:Addgene_107796)

  • For your References section:

    A noncanonical role for dynamin-1 in regulating early stages of clathrin-mediated endocytosis in non-neuronal cells. Srinivasan S, Burckhardt CJ, Bhave M, Chen Z, Chen PH, Wang X, Danuser G, Schmid SL. PLoS Biol. 2018 Apr 18;16(4):e2005377. doi: 10.1371/journal.pbio.2005377. eCollection 2018 Apr. 10.1371/journal.pbio.2005377 PubMed 29668686
Related items:
Commonly requested with: