Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mmu-miR-30a natural design (NAT)
(Plasmid #107791)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107791 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA6.2-GW/EmGFP
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5699
  • Total vector size (bp) 5770
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    whole pre-mmu-miR-30a gene
  • Alt name
    miR-30a
  • Alt name
    miR-30a-5p
  • gRNA/shRNA sequence
    GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAAATGGGCTTTCAGTCGGATGTTTGCAGCTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Mir30a (a.k.a. Mirn30a, mir-30a, mmu-mir-30a)
  • Promoter CMV
  • Tag / Fusion Protein
    • EmGFP (N terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Whole pre-mmu-miR-30a gene (miRBase ID: MI0000144) was cloned into the plasmid. It generates a pre-mmu-miR-30a, which matures to mmu-miR-30a-5p and potentially to mmu-miR-30a-3p. Plasmid constructed by Marc Beltrà in the Penna lab.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mmu-miR-30a natural design (NAT) was a gift from Fabio Penna (Addgene plasmid # 107791 ; http://n2t.net/addgene:107791 ; RRID:Addgene_107791)