mmu-miR-30a natural design (NAT)
(Plasmid #107791)

• Purpose: miR-30a RNAi Expression
• Depositing Lab: Fabio Penna
• Publication: Mmu-miR-30a Marc Beltrà plasmids (unpublished)

Backbone

• Vector backbone: pcDNA6.2-GW/EmGFP
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5699
• Total vector size (bp): 5770
• Vector type: Mammalian Expression, RNAi

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: whole pre-mmu-miR-30a gene
• Alt name: miR-30a
• Alt name: miR-30a-5p
• gRNA/shRNA sequence: GCGACTGTAAACATCCTCGACTGGAAGCTGTGAAGCCACAAATGGGCTTTCAGTCGGATGTTTGCAGCTGC
• Species: M. musculus (mouse)
• Entrez Gene: Mir30a (a.k.a. Mirn30a, mir-30a, mmu-mir-30a)
• Promoter: CMV
• Tag / Fusion Protein:
  • EmGFP (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C

Resource Information

• Supplemental Documents:
  • Mmu-miR-30a Marc Beltrà plasmids

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Whole pre-mmu-miR-30a gene (miRBase ID: MI0000144) was cloned into the plasmid. It generates a pre-mmu-miR-30a, which matures to mmu-miR-30a-5p and potentially to mmu-miR-30a-3p. Plasmid constructed by Marc Beltrà in the Penna lab.