-
PurposeKey genes: "mini-CcaS #10", ho1, pcyA, spectinomycin resistance, and medium copy backbone (p15a)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107746 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepACYCDuet-1
- Backbone size w/o insert (bp) 2550
- Total vector size (bp) 5409
-
Modifications to backboneMedium copy p15A
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCcaS
-
Alt namemini CcaS #10
-
SpeciesSynthetic; Synechocystis sp. PCC 6803
-
Insert Size (bp)1389
-
MutationDeleted AA 223 and 512
- Promoter J23106
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GCGAGGAAGCGGAATATATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHo1
-
SpeciesSynthetic; Synechocystis sp. PCC 6803
-
Insert Size (bp)723
-
GenBank ID
- Promoter J23108
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer TAGTAAATCACTGCATAATTCGTGTCG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namePcyA
-
SpeciesSynthetic; Synechocystis sp. PCC 6803
-
Insert Size (bp)747
- Promoter J23106
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer GGTGTTCAACAGCCTCACCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNO286-3 was a gift from Jeffrey Tabor (Addgene plasmid # 107746 ; http://n2t.net/addgene:107746 ; RRID:Addgene_107746) -
For your References section:
A miniaturized E. coli green light sensor with high dynamic range. Ong NTX, Tabor JJ. Chembiochem. 2018 Feb 8. doi: 10.1002/cbic.201800007. 10.1002/cbic.201800007 PubMed 29420866