Skip to main content
Addgene

pCDH-EFIa-Id1-PGK-puro
(Plasmid #107735)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107735 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDH-EF1mcs-PGKpuro
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 8650
  • Total vector size (bp) 9589
  • Modifications to backbone
    Used pCDH-CMV-MCS-copGFP stock plasmid CD511B-1 from System Biosciences. Modified by replacing CMV promoter with EF1 and replacing copGFP with PGKpuro
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Id1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    939
  • GenBank ID
    NM_010495 NM_010495
  • Entrez Gene
    T (a.k.a. Bra, D17Mit170, Low, Lr, T1, Tbxt, Tl2, Tl3, cou, me75)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer ATGAAGGTCGCCAGTGGCAGTGCC
  • 3′ sequencing primer TCAGCGACACAAGATGCGATCGTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EFIa-Id1-PGK-puro was a gift from Alexandre Colas (Addgene plasmid # 107735 ; http://n2t.net/addgene:107735 ; RRID:Addgene_107735)

  • For your References section:

    Id genes are essential for early heart formation. Cunningham TJ, Yu MS, McKeithan WL, Spiering S, Carrette F, Huang CT, Bushway PJ, Tierney M, Albini S, Giacca M, Mano M, Puri PL, Sacco A, Ruiz-Lozano P, Riou JF, Umbhauer M, Duester G, Mercola M, Colas AR. Genes Dev. 2017 Aug 9. pii: gad.300400.117. doi: 10.1101/gad.300400.117. 10.1101/gad.300400.117 PubMed 28794185
Related items:
Commonly requested with: