TetO-FUW-BICRAL-FLAG-pgk-puro
(Plasmid #107732)

• Purpose: Tet inducible lentiviral C-terminal FLAG BICRAL (GLTSCR1L) ORF
• Depositing Lab: Emily Dykhuizen
• Publication: Alpsoy et al J Biol Chem. 2018 Jan 26. pii: RA117.001065. doi: 10.1074/jbc.RA117.001065.

Backbone

• Vector backbone: TetO-FUW-pgk-puro
• Backbone size w/o insert (bp): 9542
• Total vector size (bp): 12822
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BICRAL
• Alt name: GLTSCR1L
• Species: H. sapiens (human)
• Insert Size (bp): 3273
• GenBank ID: NM_001318819
• Entrez Gene: BICRAL (a.k.a. GLTSCR1L, KIAA0240)
• Promoter: CMV
• Tag / Fusion Protein:
  • FLAG (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAGAGCTCGTTTAGTGAACCG
• 3′ sequencing primer: CGCCAAGTGCCCAGC

Resource Information

• Supplemental Documents:
  • fuwbicralflag-wideseq.gb
• A portion of this plasmid was derived from a plasmid made by: Subcloned from an Novogen construct 762821-2
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry