Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pN3-SP4FL
(Plasmid #107719)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107719 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pN3
  • Backbone manufacturer
    Guntram Suske (Addgene plasmid # 24544)
  • Backbone size w/o insert (bp) 3996
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Sp4
  • Alt name
    Sp4 transcription factor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2908
  • Entrez Gene
    SP4 (a.k.a. HF1B, SPR-1)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The plasmid is related to the Addgene plasmids pN3-Sp1FL (#24543), pN3-Sp3FL (#24541) and pN3-Control (#24544)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN3-SP4FL was a gift from Guntram Suske (Addgene plasmid # 107719 ; http://n2t.net/addgene:107719 ; RRID:Addgene_107719)