pN3-Sp2FL
(Plasmid
#107718)
-
PurposeExpression plasmid for full length murine Sp2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepN3
-
Backbone manufacturerGuntram Suske (Addgene plasmid # 24544)
- Backbone size w/o insert (bp) 3996
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp2
-
Alt nameSp2 transcription factor
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2963
-
Entrez GeneSp2 (a.k.a. mKIAA0048, 4930480I16Rik)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV-for (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer SV40-pA-rev (CCTCACAAATGTGGTATGG) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid is related to the Addgene plasmids pN3-Sp1FL (#24543), pN3-Sp3FL (#24541) and pN3-Control (#24544)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN3-Sp2FL was a gift from Guntram Suske (Addgene plasmid # 107718 ; http://n2t.net/addgene:107718 ; RRID:Addgene_107718)