pN3-MGA
(Plasmid #107715)

• Purpose: Expression plasmid for 3xFLAG-tagged MGA
• Depositing Lab: Guntram Suske
• Publication: Stielow et al PLoS Genet. 2018 Jan 30;14(1):e1007193. doi: 10.1371/journal.pgen.1007193.

Backbone

• Vector backbone: pN3-3xFlag
• Backbone size w/o insert (bp): 4063
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MGA
• Alt name: MGAP
• Alt name: MAX gene-associated protein
• Species: H. sapiens (human)
• Insert Size (bp): 9362
• Entrez Gene: MGA (a.k.a. MAD5, MXD5)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3xFlag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 3′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CMV-for (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: SV40-pA-rev (CCTCACAAATGTGGTATGG)

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The plasmid encodes the 3115 amino acid full-length MGA isoform XP_005254303.1