pCre-SacB-zeo
(Plasmid #107706)

• Purpose: Expresses Cre recombinase for excising chromosomal loxP-Hyg-loxP cassette inserts.
• Depositing Lab: Kenan Murphy
• Publication: Murphy et al Methods Mol Biol. 2015;1285:177-99. doi: 10.1007/978-1-4939-2450-9_10.

Backbone

• Vector backbone: pCre-SacB-kan
• Backbone manufacturer: Adrie J.C. Steyn
• Backbone size w/o insert (bp): 8248
• Total vector size (bp): 8623
• Modifications to backbone: Used E. coli recombineering to replace the kanamycin-resistant cassette with a zeocin-resistance cassette.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ble (Zeo resistance)
• Insert Size (bp): 375

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TCGCAGACCGATACCAGGATCTTG
• 3′ sequencing primer: CGGGGTGCACTCATCATAGTGCAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Eric Rubin, Harvard School of Public Health

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry