pTU1-A-pdh_RiboJ_mCherry_Bba_B0015
(Plasmid #107581)

• Purpose: B. megaterium DSM319 pdh promoter, mCherry (Bacillus codon optimised) for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)
• Depositing Lab: Paul Freemont
• Publication: Moore et al Proc Natl Acad Sci U S A. 2018 Apr 17. pii: 1715806115. doi: 10.1073/pnas.1715806115.

Backbone

• Vector backbone: pTU1-A - EcoFlex (Moore et al, 2016 - PubMed PMID: 27096716)
• Backbone manufacturer: N/A
• Backbone size w/o insert (bp): 5922
• Total vector size (bp): 6633
• Modifications to backbone: EcoFlex backbone (AmpR + pMB1) and Bacillus origin of replication (rebM) and tetracycline resistance (tetA)
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: 100 ug/ml ampicillin in E. coli 5 ug/ml tetracycline in Bacillus
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Promoter: pdh promoter Bacillus megaterium DSM319

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: See Moore et al, 2016 - PubMed PMID: 27096716 (destroyed during cloning)
• 3′ cloning site: EcoFlex assembly (destroyed during cloning)
• 5′ sequencing primer: BM_VF; gctttcgctaaggatgatttctg
• 3′ sequencing primer: BM_VR; cgaaagggcctcgtgatac

Resource Information

• Supplemental Documents:
  • pTU1-A-pdh_RiboJ_mCherry_Bmeg.gb
• A portion of this plasmid was derived from a plasmid made by: Dr Rebekka Biedendieck and Professor Dieter Jahn - Braunschweig Technical University

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mCherry - 31% G+C% codon optimised for expression in Bacillus species