Skip to main content
Addgene

pPLtetO-FtsA
(Plasmid #107558)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107558 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJKR-L-tetR
  • Modifications to backbone
    Replaced GFP with FtsZ
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BW 25113
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ftsA
  • Species
    Escherichia coli
  • Insert Size (bp)
    1263
  • GenBank ID
    944786
  • Promoter pLtetO

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAGGACAAATCCGCCGGGAG
  • 3′ sequencing primer GGGTTGTTAAACCTTCGATTCCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that an IS4 transposase sequence was found between TetR and AmpR during Addgene's quality control. The depositor noted that this sequence should NOT affect plasmid function.

Please visit https://www.biorxiv.org/content/early/2018/05/04/314922 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPLtetO-FtsA was a gift from Uwe Sauer (Addgene plasmid # 107558 ; http://n2t.net/addgene:107558 ; RRID:Addgene_107558)
  • For your References section:

    Synthesis and degradation of FtsZ quantitatively predict the first cell division in starved bacteria. Sekar K, Rusconi R, Sauls JT, Fuhrer T, Noor E, Nguyen J, Fernandez VI, Buffing MF, Berney M, Jun S, Stocker R, Sauer U. Mol Syst Biol. 2018 Nov 5;14(11):e8623. doi: 10.15252/msb.20188623. 10.15252/msb.20188623 PubMed 30397005