pPLtetO-FtsA
(Plasmid
#107558)
-
PurposePlasmid for titrating synthesis of FtsA with doxycycline
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJKR-L-tetR
-
Modifications to backboneReplaced GFP with FtsZ
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)BW 25113
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameftsA
-
SpeciesEscherichia coli
-
Insert Size (bp)1263
-
GenBank ID944786
- Promoter pLtetO
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAGGACAAATCCGCCGGGAG
- 3′ sequencing primer GGGTTGTTAAACCTTCGATTCCGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that an IS4 transposase sequence was found between TetR and AmpR during Addgene's quality control. The depositor noted that this sequence should NOT affect plasmid function.
Please visit https://www.biorxiv.org/content/early/2018/05/04/314922 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPLtetO-FtsA was a gift from Uwe Sauer (Addgene plasmid # 107558 ; http://n2t.net/addgene:107558 ; RRID:Addgene_107558) -
For your References section:
Synthesis and degradation of FtsZ quantitatively predict the first cell division in starved bacteria. Sekar K, Rusconi R, Sauls JT, Fuhrer T, Noor E, Nguyen J, Fernandez VI, Buffing MF, Berney M, Jun S, Stocker R, Sauer U. Mol Syst Biol. 2018 Nov 5;14(11):e8623. doi: 10.15252/msb.20188623. 10.15252/msb.20188623 PubMed 30397005