pTE4567
(Plasmid #107557)

• Purpose: Expresses human codon optimized inactive MbCpf1(dead2) in mammalian cells.
• Depositing Lab: Ervin Welker
• Publication: Toth et al Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 5405
• Total vector size (bp): 9662
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hMbCpf1(dead2)
• Alt name: human codon optimized inactive Moraxella bovoculi Cpf1 nuclease (dead2)
• Insert Size (bp): 4257
• Mutation: E1080A
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry