pAAV-AICD-NLS-IRES-hrGFP
(Plasmid
#107543)
-
PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-IRES-hrGFP
-
Backbone manufacturerAgilent Technologies
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAICD-NLS
-
SpeciesH. sapiens (human)
-
MutationNone
-
Entrez GeneAPP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ATTCTGAGTCCAAGCTAGGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Flag tag is not in frame with the insert
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-AICD-NLS-IRES-hrGFP was a gift from Hélène Marie (Addgene plasmid # 107543 ; http://n2t.net/addgene:107543 ; RRID:Addgene_107543) -
For your References section:
Physiological and pathophysiological control of synaptic GluN2B-NMDA receptors by the C-terminal domain of amyloid precursor protein. Pousinha PA, Mouska X, Raymond EF, Gwizdek C, Dhib G, Poupon G, Zaragosi LE, Giudici C, Bethus I, Pacary E, Willem M, Marie H. Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659. 10.7554/eLife.25659 PubMed 28682239