pAAV-AICD-NLS-IRES-hrGFP
(Plasmid #107543)

• Purpose: AAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFP
• Depositing Lab: Hélène Marie
• Publication: Pousinha et al Elife. 2017 Jul 6;6. doi: 10.7554/eLife.25659.

Backbone

• Vector backbone: pAAV-IRES-hrGFP
• Backbone manufacturer: Agilent Technologies
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AICD-NLS
• Species: H. sapiens (human)
• Mutation: None
• Entrez Gene: APP (a.k.a. AAA, ABETA, ABPP, AD1, APPI, CTFgamma, CVAP, PN-II, PN2, alpha-sAPP, preA4)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: ATTCTGAGTCCAAGCTAGGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Flag tag is not in frame with the insert