pTE3328
(Plasmid #107539)

• Purpose: Expresses As crRNA and human codon optimized AsCpf1(RR mutant) in mammalian cells.
• Depositing Lab: Ervin Welker
• Publication: Toth et al Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815.

Backbone

• Vector backbone: pcDNA3.1
• Backbone size w/o insert (bp): 4482
• Total vector size (bp): 9719
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: As crRNA
• Alt name: CRISPR RNA for Acidaminococcus sp. Cpf1 nuclease
• Insert Size (bp): 47
• Promoter: human U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AAAACAGGAAGGCAAAATGC

Gene/Insert 2

• Gene/Insert name: hAsCpf1(RR mutant)
• Alt name: human codon optimized Acidaminococcus sp. Cpf1 nuclease (RR mutant)
• Insert Size (bp): 4107
• Mutation: S542R, K607R
• Promoter: CMV
• Tags / Fusion Proteins:
  • NLS (C terminal on insert)
  • 3xHA (C terminal on insert)
  • SV40 NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry