Skip to main content
Addgene

pTE3317
(Plasmid #107531)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107531 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5403
  • Total vector size (bp) 9662
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMbCpf1(RVR)
  • Alt name
    human codon optimized Moraxella Cpf1 nuclease (RVR mutant)
  • Insert Size (bp)
    4252
  • Mutation
    N576R, K582V, N586R
  • Promoter CMV
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTE3317 was a gift from Ervin Welker (Addgene plasmid # 107531 ; http://n2t.net/addgene:107531 ; RRID:Addgene_107531)

  • For your References section:

    Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Toth E, Czene BC, Kulcsar PI, Krausz SL, Talas A, Nyeste A, Varga E, Huszar K, Weinhardt N, Ligeti Z, Borsy AE, Fodor E, Welker E. Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815. 10.1093/nar/gky815 PubMed 30239882
Related items: