pTE4561
(Plasmid #107525)

• Purpose: Expresses Lb crRNA and mCherry in mammalian cells.
• Depositing Lab: Ervin Welker
• Publication: Toth et al Nucleic Acids Res. 2018 Sep 20. pii: 5103950. doi: 10.1093/nar/gky815.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 3061
• Total vector size (bp): 4885
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Lb crRNA
• Alt name: CRISPR RNA for Lachnospiraceae bacterium Cpf1 nuclease
• Insert Size (bp): 48
• Promoter: human U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CCTCTGACTTGAGCGTCG

Gene/Insert 2

• Gene/Insert name: mCherry
• Alt name: mCherry fluorescent protein
• Insert Size (bp): 708
• Promoter: CBh

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ggctgttagagagataattgg
• 3′ sequencing primer: CATTTTATGTTTCAGGTTCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry