Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FoxFTVC+bpFOG_MRAS-G22V
(Plasmid #107521)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107521 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCESA
  • Backbone size w/o insert (bp) 2600
  • Total vector size (bp) 3759

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    M-Ras protein
  • Alt name
    small GTPase
  • Insert Size (bp)
    600
  • Mutation
    changed Glycine 22 to Valine
  • GenBank ID
    XP_002121859.1
  • Promoter TVC-specific FoxF enhancer (FoxFTVC+bpFOG)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer cattaacctataaaaataggcgtatca
  • 3′ sequencing primer ggatttccttacgcgaaatacg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FoxFTVC+bpFOG_MRAS-G22V was a gift from Lionel Christiaen (Addgene plasmid # 107521 ; http://n2t.net/addgene:107521 ; RRID:Addgene_107521)
  • For your References section:

    An FGF-driven feed-forward circuit patterns the cardiopharyngeal mesoderm in space and time. Razy-Krajka F, Gravez B, Kaplan N, Racioppi C, Wang W, Christiaen L. Elife. 2018 Feb 6;7. pii: 29656. doi: 10.7554/eLife.29656. PubMed 29431097