eMscL G22S
(Plasmid #107455)

• Purpose: eMscL G22S is optimized for mammalian rodent neuronal expression to the plasma membrane through a neuron-specific promoter and a voltage-gated channel targeting motif
• Depositing Lab: Francesco Difato
• Publication: Soloperto et al J Cell Sci. 2018 Jan 29. pii: jcs.210393. doi: 10.1242/jcs.210393.

Backbone

• Vector backbone: pAAV2
• Total vector size (bp): 6513
• Vector type: Mammalian Expression ; Adeno-associated viral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: bacterial mechanosensitive ion channel of large conductance
• Alt name: mscL
• Species: Escherichia coli
• Insert Size (bp): 411
• Mutation: Bearing a glycine to serine substitution at position 22
• Entrez Gene: mscL (a.k.a. b3291, ECK3277, yhdC)
• Promoter: human synapsin 1
• Tags / Fusion Proteins:
  • tdTomato fluorescence protein (C terminal on insert)
  • Kir2.1 ER export signal (FCYENEV) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: 5’ - CTGCCTCAGTCTGCGGTGGG - 3’

Resource Information

• Supplemental Documents:
  • pAAV2_hSyn_eMscL(G22S)_tdTOMATO.txt
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry