pYES2.1-cerMET5
(Plasmid #107437)

• Purpose: Overexpression of MET fusion protein in S. cerevisiae
• Depositing Lab: Clare O'Connor
• Publication: Reeves et al CBE Life Sci Educ. 2018 Spring;17(1). pii: 17/1/ar1. doi: 10.1187/cbe.17-01-0012.

Backbone

• Vector backbone: pYES2.1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5886
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MET5
• Alt name: ECM17
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 4326
• Mutation: V81I, K341E, P597L, Y605C, E741G, D932G, N1217S, H1335R
• Entrez Gene: MET5 (a.k.a. YJR137C, ECM17)
• Promoter: GAL1
• Tag / Fusion Protein:
  • V5-His (C terminal on insert)

Cloning Information

• Cloning method: TOPO Cloning
• 5′ sequencing primer: AATATACCTCTATACTTTAACGTC
• 3′ sequencing primer: ACCGAGGAGAGGGTTAGGGAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

contains the coding sequence for the beta subunit of sulfite reductase

Construct was not functional in complementation analysis, but this may be due to tags rather than mutations in the coding sequence. Use with caution.