Skip to main content
Addgene

pIBA2-SpyTag-MBP
(Plasmid #107422)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107422 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pASK-IBA2
  • Backbone manufacturer
    IBA GmbH
  • Backbone size w/o insert (bp) 3286
  • Total vector size (bp) 4354
  • Modifications to backbone
    deletion of residues 202-276
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Maltose-binding protein (MalE)
  • Alt name
    MBP
  • Species
    E. coli
  • Insert Size (bp)
    1098
  • GenBank ID
    WP_052916395
  • Promoter Tet
  • Tags / Fusion Proteins
    • OmpA signal peptide (N terminal on backbone)
    • SpyTag (N terminal on insert)
    • StrepII (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTTATTTTACCACTCCCT
  • 3′ sequencing primer CGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Spycatcher was published in Zakeri et al. (2012), PNAS 109, ppE690-7

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIBA2-SpyTag-MBP was a gift from Jack Leo (Addgene plasmid # 107422 ; http://n2t.net/addgene:107422 ; RRID:Addgene_107422)
  • For your References section:

    Insights into the autotransport process of a trimeric autotransporter, Yersinia Adhesin A (YadA). Chauhan N, Hatlem D, Orwick-Rydmark M, Schneider K, Floetenmeyer M, van Rossum B, Leo JC, Linke D. Mol Microbiol. 2019 Jan 1. doi: 10.1111/mmi.14195. 10.1111/mmi.14195 PubMed 30600549