pIBA3-SpyCatcherEQ-sfGFP
(Plasmid #107421)

• Purpose: For production of inactive SpyCatcherEQ protein fused N-terminally to sfGFP. Includes N-terminal His tag for purification and C-terminal StrepII tag for detection.
• Depositing Lab: Jack Leo
• Publication: Chauhan et al Mol Microbiol. 2019 Jan 1. doi: 10.1111/mmi.14195.

Backbone

• Vector backbone: pASK-IBA3
• Backbone manufacturer: IBA GmbH
• Backbone size w/o insert (bp): 3226
• Total vector size (bp): 4234
• Modifications to backbone: deletion of residues 142-216
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: SpyCatcher
• Species: Synthetic
• Insert Size (bp): 1083
• Mutation: mutation of glutamate 77 to glutamine
• GenBank ID: AFD50637
• Promoter: Tet
• Tags / Fusion Proteins:
  • His tag (N terminal on insert)
  • superfolder GFP (C terminal on insert)
  • StrepII (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAGTTATTTTACCACTCCCT
• 3′ sequencing primer: CGCAGTAGCGGTAAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene (Mark Howarth lab)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Spycatcher was published in Zakeri et al. (2012), PNAS 109, ppE690-7; amino acid numbering is based on the sequence in this article.