Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIBA3-SpyCatcherEQ-sfGFP
(Plasmid #107421)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107421 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pASK-IBA3
  • Backbone manufacturer
    IBA GmbH
  • Backbone size w/o insert (bp) 3226
  • Total vector size (bp) 4234
  • Modifications to backbone
    deletion of residues 142-216
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    SpyCatcher
  • Species
    Synthetic
  • Insert Size (bp)
    1083
  • Mutation
    mutation of glutamate 77 to glutamine
  • GenBank ID
    AFD50637
  • Promoter Tet
  • Tags / Fusion Proteins
    • His tag (N terminal on insert)
    • superfolder GFP (C terminal on insert)
    • StrepII (C terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGTTATTTTACCACTCCCT
  • 3′ sequencing primer CGCAGTAGCGGTAAACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene (Mark Howarth lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Spycatcher was published in Zakeri et al. (2012), PNAS 109, ppE690-7; amino acid numbering is based on the sequence in this article.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIBA3-SpyCatcherEQ-sfGFP was a gift from Jack Leo (Addgene plasmid # 107421 ; http://n2t.net/addgene:107421 ; RRID:Addgene_107421)
  • For your References section:

    Insights into the autotransport process of a trimeric autotransporter, Yersinia Adhesin A (YadA). Chauhan N, Hatlem D, Orwick-Rydmark M, Schneider K, Floetenmeyer M, van Rossum B, Leo JC, Linke D. Mol Microbiol. 2019 Jan 1. doi: 10.1111/mmi.14195. 10.1111/mmi.14195 PubMed 30600549