pMB1-spect-PthrC3_7-eGFP
(Plasmid
#107412)
-
PurposeThis plasmid contain promoter PthrC3_7, which is used for study about Short, Auto-inducible Promoters for Well-Controlled Protein Expression in Escherichia coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107412 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMB1-spect-PthrC3_7
- Backbone size w/o insert (bp) 3291
- Total vector size (bp) 711
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse strain BL21(DE3) for expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
GenBank IDKY014123.1
- Promoter PthrC3_7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTTTCATTCTGACTGCA
- 3′ sequencing primer GGTTGTTACCTCGTTACCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMB1-spect-PthrC3_7-eGFP was a gift from Kang Zhou (Addgene plasmid # 107412 ; http://n2t.net/addgene:107412 ; RRID:Addgene_107412) -
For your References section:
Short, auto-inducible promoters for well-controlled protein expression in Escherichia coli. Anilionyte O, Liang H, Ma X, Yang L, Zhou K. Appl Microbiol Biotechnol. 2018 Aug;102(16):7007-7015. doi: 10.1007/s00253-018-9141-z. Epub 2018 Jun 8. 10.1007/s00253-018-9141-z PubMed 29948110