Skip to main content
Addgene

pCOLA kiwi sensor sfGFP
(Plasmid #107368)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107368 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCOLADuet-1
  • Backbone manufacturer
    Novagen 71406-3
  • Backbone size w/o insert (bp) 3340
  • Total vector size (bp) 4160
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    kiwi-detecting toehold + sfGFP
  • Insert Size (bp)
    823
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tttttcccgcgttttcgca
  • 3′ sequencing primer ctagcataaccccttggggc
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCOLA kiwi sensor sfGFP was a gift from James Collins (Addgene plasmid # 107368 ; http://n2t.net/addgene:107368 ; RRID:Addgene_107368)

  • For your References section:

    BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608
Related items:
Commonly requested with: