pNP1 sfGFP trigger
(Plasmid
#107359)
-
PurposeTrigger sequence for pNP1 sfGFP toehold switch
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepNP1
-
Backbone manufacturerNew England Biolabs (cloning vector)
- Backbone size w/o insert (bp) 2053
- Total vector size (bp) 2116
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametoehold trigger 7
-
Insert Size (bp)63
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCCGCGAAATTAATACGACTCACTATAGG
- 3′ sequencing primer AGTGCCAAGCTTCCGGATATAGTTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGreen, A.A., Silver, P.A., Collins, J.J., and Yin, P. (2014). Toehold switches: de-novo-designed regulators of gene expression. Cell 159, 925–939.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNP1 sfGFP trigger was a gift from James Collins (Addgene plasmid # 107359 ; http://n2t.net/addgene:107359 ; RRID:Addgene_107359) -
For your References section:
BioBits Explorer: A modular synthetic biology education kit. Huang A, Nguyen PQ, Stark JC, Takahashi MK, Donghia N, Ferrante T, Dy AJ, Hsu KJ, Dubner RS, Pardee K, Jewett MC, Collins JJ. Sci Adv. 2018 Aug 1;4(8):eaat5105. doi: 10.1126/sciadv.aat5105. eCollection 2018 Aug. 10.1126/sciadv.aat5105 PubMed 30083608