pCT-CMV-UBE3BΔHECT-copGFP-Puro
(Plasmid
#107343)
-
PurposeExpresses UBE3B deletion of HECT domain fused to copGFP in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107343 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCYTO-CMV-MCS-copGFP-EF1-Puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 10393
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUBE3B(ΔHECT)-copGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3046
-
Mutationdeletion of HECT domain (757-end)
-
Entrez GeneUBE3B (a.k.a. BPIDS, KOS)
- Promoter CMV
-
Tag
/ Fusion Protein
- copGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer ATTCTAGACACCATGTTCACCCTGTCTCAGACCTCG
- 3′ sequencing primer ATCGGATCCAATCCCCACTGGTTGTCTTGAACAGATT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCT-CMV-UBE3BΔHECT-copGFP-Puro was a gift from Robert Sobol (Addgene plasmid # 107343 ; http://n2t.net/addgene:107343 ; RRID:Addgene_107343) -
For your References section:
UBE3B is a Calmodulin-Regulated, Mitochondria-Associated E3 Ubiquitin Ligase. Braganza A, Li J, Zeng X, Yates NA, Dey NB, Andrews J, Clark J, Zamani L, Wang XH, St Croix C, O'Sullivan R, Garcia-Exposito L, Brodsky JL, Sobol RW. J Biol Chem. 2016 Dec 21. pii: jbc.M116.766824. doi: 10.1074/jbc.M116.766824. 10.1074/jbc.M116.766824 PubMed 28003368