pCT-CMV-UBE3B-copGFP-Puro
(Plasmid
#107342)
-
PurposeExpresses UBE3B fused to copGFP in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCYTO-CMV-MCS-copGFP-EF1-Puro
-
Backbone manufacturerSystem Biosciences
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 11359
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbiquitin-protein ligase E3B
-
Alt nameUBE3B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4008
-
Entrez GeneUBE3B (a.k.a. BPIDS, KOS)
- Promoter CMV
-
Tag
/ Fusion Protein
- copGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer ATTCTAGACACCATGTTCACCCTGTCTCAGACCTCG
- 3′ sequencing primer TAGCTCTAGAATGGAGAGTTCAAAGCCCGTGTTCATGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCT-CMV-UBE3B-copGFP-Puro was a gift from Robert Sobol (Addgene plasmid # 107342 ; http://n2t.net/addgene:107342 ; RRID:Addgene_107342) -
For your References section:
UBE3B is a Calmodulin-Regulated, Mitochondria-Associated E3 Ubiquitin Ligase. Braganza A, Li J, Zeng X, Yates NA, Dey NB, Andrews J, Clark J, Zamani L, Wang XH, St Croix C, O'Sullivan R, Garcia-Exposito L, Brodsky JL, Sobol RW. J Biol Chem. 2016 Dec 21. pii: jbc.M116.766824. doi: 10.1074/jbc.M116.766824. 10.1074/jbc.M116.766824 PubMed 28003368