Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBluescript_VEGFA-TS3_NmCas9
(Plasmid #107329)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107329 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBluescript
  • Total vector size (bp) 3342
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VEGFA-TS3 sgRNA
  • gRNA/shRNA sequence
    GCGGGGAGAAGGCCAGGGGTCACT
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuAI (destroyed during cloning)
  • 3′ cloning site BfuAI (destroyed during cloning)
  • 5′ sequencing primer T3
  • 3′ sequencing primer T7
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBluescript_VEGFA-TS3_NmCas9 was a gift from Scot Wolfe (Addgene plasmid # 107329 ; http://n2t.net/addgene:107329 ; RRID:Addgene_107329)
  • For your References section:

    Orthogonal Cas9-Cas9 chimeras provide a versatile platform for genome editing. Bolukbasi MF, Liu P, Luk K, Kwok SF, Gupta A, Amrani N, Sontheimer EJ, Zhu LJ, Wolfe SA. Nat Commun. 2018 Nov 19;9(1):4856. doi: 10.1038/s41467-018-07310-x. 10.1038/s41467-018-07310-x PubMed 30451839