t2. pT7-7-SNCA-5Lys
(Plasmid
#107294)
-
PurposePlasmid for the expression of the construct SNCA-5Lys. Alpha-Synuclein with 12 aa C-terminal moiety, which consists of 5 Lys and 7 Gly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107294 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepT7-7
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNCA-5Lys
-
SpeciesH. sapiens (human)
-
Insert Size (bp)456
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T-7 primer
- 3′ sequencing primer ATTAATATTGGTAACTGTCAGACCAAGTTTACTCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
t2. pT7-7-SNCA-5Lys was a gift from Dmytro Yushchenko (Addgene plasmid # 107294 ; http://n2t.net/addgene:107294 ; RRID:Addgene_107294) -
For your References section:
Modification of C Terminus Provides New Insights into the Mechanism of alpha-Synuclein Aggregation. Afitska K, Fucikova A, Shvadchak VV, Yushchenko DA. Biophys J. 2017 Nov 21;113(10):2182-2191. doi: 10.1016/j.bpj.2017.08.027. Epub 2017 Sep 20. 10.1016/j.bpj.2017.08.027 PubMed 28939194