1a. pETM11-SUMO-SNCA-GFP
(Plasmid
#107292)
-
PurposePlasmid for the expression of the construct alpha-Synuclein-GFP, which contains N-terminal tags, which can be cleaved later: His-tag for purification and SUMO-tag for better solubility
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepETM11
-
Vector typeBacterial Expression
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNCA-GFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1170
-
Entrez GeneSNCA (a.k.a. NACP, PARK1, PARK4, PD1)
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag and SUMO-tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T-7 primer
- 3′ sequencing primer TATATACTGCTTGTTGCTGATGGCGTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1a. pETM11-SUMO-SNCA-GFP was a gift from Dmytro Yushchenko (Addgene plasmid # 107292 ; http://n2t.net/addgene:107292 ; RRID:Addgene_107292) -
For your References section:
Modification of C Terminus Provides New Insights into the Mechanism of alpha-Synuclein Aggregation. Afitska K, Fucikova A, Shvadchak VV, Yushchenko DA. Biophys J. 2017 Nov 21;113(10):2182-2191. doi: 10.1016/j.bpj.2017.08.027. Epub 2017 Sep 20. 10.1016/j.bpj.2017.08.027 PubMed 28939194