pMTgR2
(Plasmid #107286)

• Purpose: Plasmid can be used for Drosophila S2 driven secretion of extracellular part of human interferon-_ receptor 2.
• Depositing Lab: Bohdan Schneider
• Publication: Mikulecky et al Acta Crystallogr D Struct Biol. 2016 Sep;72(Pt 9):1017-25. doi: 10.1107/S2059798316012237. Epub 2016 Aug 18.

Backbone

• Vector backbone: pMT-BiP-V5-His
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 3646
• Vector type: Insect Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Interferon gamma receptor 2
• Alt name: IFNgR2
• Species: H. sapiens (human)
• Insert Size (bp): 660
• Entrez Gene: IFNGR2 (a.k.a. AF-1, IFGR2, IFNGT1, IMD28)
• Promoter: Metallothionein promoter
• Tag / Fusion Protein:
  • CATCATCACCATCACCATGA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AGATCT (not destroyed)
• 3′ cloning site: ACCGGT (not destroyed)
• 5′ sequencing primer: MT Forward, CATCTCAGTGCAACTAAA (Invitrogen)
• 3′ sequencing primer: BGH reverse: TAGAAGGCACAGTCGAGG (ThermoFisher)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Crystal structure of the extracellular part of receptor 2 of human interferon gamma; PDB ID 5eh1; doi: 10.1107/S2059798316012237