pAGH23
(Plasmid #107262)

• Purpose: contains CurT-mTurquoise2 construct used to replace the native CurT in Synechocystis PCC 6803 via homologous recombination.
• Depositing Lab: Erin O'Shea
• Publication: Gutu et al Mol Microbiol. 2018 Jan 22. doi: 10.1111/mmi.13912.

Backbone

• Vector backbone: pBR322
• Backbone size w/o insert (bp): 4600
• Total vector size (bp): 9300
• Modifications to backbone: used gibson to clone the chimeric insert into pBR322 linearized with EcoRV and NheI.
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: curT
• Alt name: slr0483
• Insert Size (bp): 4700
• Entrez Gene: slr0483 (a.k.a. SYNGTS_2353)
• Promoter: native CurT promoter
• Tag / Fusion Protein:
  • mTurquoise2 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TACAGTTGATCGGCATGGGC
• 3′ sequencing primer: AGGGGAGGAAGAATGGCGAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

this plasmid has also been used in:
Heinz et al., Plant Cell 2016, DOI: https://doi.org/10.1105/tpc.16.00491