pAGH23
(Plasmid
#107262)
-
Purposecontains CurT-mTurquoise2 construct used to replace the native CurT in Synechocystis PCC 6803 via homologous recombination.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4600
- Total vector size (bp) 9300
-
Modifications to backboneused gibson to clone the chimeric insert into pBR322 linearized with EcoRV and NheI.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namecurT
-
Alt nameslr0483
-
Insert Size (bp)4700
-
Entrez Geneslr0483 (a.k.a. SYNGTS_2353)
- Promoter native CurT promoter
-
Tag
/ Fusion Protein
- mTurquoise2 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACAGTTGATCGGCATGGGC
- 3′ sequencing primer AGGGGAGGAAGAATGGCGAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this plasmid has also been used in:
Heinz et al., Plant Cell 2016, DOI: https://doi.org/10.1105/tpc.16.00491
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGH23 was a gift from Erin O'Shea (Addgene plasmid # 107262 ; http://n2t.net/addgene:107262 ; RRID:Addgene_107262) -
For your References section:
Dynamical localization of a thylakoid membrane binding protein is required for acquisition of photosynthetic competency. Gutu A, Chang F, O'Shea EK. Mol Microbiol. 2018 Jan 22. doi: 10.1111/mmi.13912. 10.1111/mmi.13912 PubMed 29357135