pAGH51
(Plasmid
#107255)
-
PurposeHU-FRB construct (anchor) expressed in trans from the slr0168 neutral site of Synechocystis PCC6803. Used to anchor away any FKBP tagged target in presence of rapamycin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4313
- Total vector size (bp) 8600
-
Modifications to backboneused gibson cloning
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHU-FRB
-
Alt namesll1712 of Synechocystis sp. PCC6803
-
Alt namehistone-like DNA binding protein
-
SpeciesSynthetic; Synecocystis sp. PCC6803
-
Insert Size (bp)4324
- Promoter native HU promoter
-
Tag
/ Fusion Protein
- FRB (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTTGTGCAATGTAACATCAGAG
- 3′ sequencing primer GTCATGATCTTCGATGTAAGTCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGH51 was a gift from Erin O'Shea (Addgene plasmid # 107255 ; http://n2t.net/addgene:107255 ; RRID:Addgene_107255) -
For your References section:
Dynamical localization of a thylakoid membrane binding protein is required for acquisition of photosynthetic competency. Gutu A, Chang F, O'Shea EK. Mol Microbiol. 2018 Jan 22. doi: 10.1111/mmi.13912. 10.1111/mmi.13912 PubMed 29357135