Skip to main content
Addgene

E.coli RaPID plasmid
(Plasmid #107251)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107251 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLEX
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E.coli BirA*
  • Promoter CMV
  • Tag / Fusion Protein
    • HA

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer atatagacaaacgcacaccggcct
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    E.coli RaPID plasmid was a gift from Paul Khavari (Addgene plasmid # 107251 ; http://n2t.net/addgene:107251 ; RRID:Addgene_107251)

  • For your References section:

    RNA-protein interaction detection in living cells. Ramanathan M, Majzoub K, Rao DS, Neela PH, Zarnegar BJ, Mondal S, Roth JG, Gai H, Kovalski JR, Siprashvili Z, Palmer TD, Carette JE, Khavari PA. Nat Methods. 2018 Feb 5. pii: nmeth.4601. doi: 10.1038/nmeth.4601. 10.1038/nmeth.4601 PubMed 29400715
Related items:
Commonly requested with: