JGE302_pAAV-hSyn-DIO-Myc-PYLcs-bArrestin2-YFP (p2)
(Plasmid #107247)

• Purpose: beta arrestin 2 fused to PYLcs for abscisic acid mediated recruitment of ABIcs labelled proteins.
• Depositing Lab: Bryan Roth
• Publication: Roth et al bioRxiv 251769

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 6597
• Total vector size (bp): 8454
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ARRB2
• Alt name: Beta Arrestin 2
• Species: Synthetic
• Insert Size (bp): 1962
• Promoter: hSYN
• Tags / Fusion Proteins:
  • MYC (N terminal on insert)
  • PYLcs (N terminal on insert)
  • YFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cgctgcctcagtctgcggtg
• 3′ sequencing primer: ggagaaaatgaaagccatacgggaagcaatag

Resource Information

• Supplemental Documents:
  • jge302_paav-hsyn-dio-myc-pylcs-barrestin2-yfp-p2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/01/22/251769 for bioRxiv preprint.

These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.