Skip to main content
Addgene

pHJ1_Full length LexA
(Plasmid #107237)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107237 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSB4K5
  • Backbone size w/o insert (bp) 6363
  • Total vector size (bp) 6999
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Full length LexA repressor
  • Species
    Synthetic
  • Insert Size (bp)
    639
  • Promoter pLacO1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGGCAACTGAAACGATTCGGATC
  • 3′ sequencing primer CACCAACGGGTTATTGATAGAACGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHJ1_Full length LexA was a gift from Jerome Bonnet (Addgene plasmid # 107237 ; http://n2t.net/addgene:107237 ; RRID:Addgene_107237)

  • For your References section:

    A Modular Receptor Platform To Expand the Sensing Repertoire of Bacteria. Chang HJ, Mayonove P, Zavala A, De Visch A, Minard P, Cohen-Gonsaud M, Bonnet J. ACS Synth Biol. 2017 Oct 30. doi: 10.1021/acssynbio.7b00266. 10.1021/acssynbio.7b00266 PubMed 28946740
Related items:
Commonly requested with: