Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

p2T-CAG-SpCas9-BlastR
(Plasmid #107190)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107190 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    sgBbsI (p2Tol-U6-2xBbsI-sgRNA-HygR)
  • Backbone manufacturer
    Richard Sherwood Lab
  • Backbone size w/o insert (bp) 6982
  • Total vector size (bp) 12083
  • Modifications to backbone
    The sequence between Tol2 sites was replaced with a CAGGS promoter, Cas9 sequence, and Blasticidin resistance cassette.
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Insert Size (bp)
    4101
  • Entrez Gene
    NEWENTRY
  • Promoter Chicken ß-actin
  • Tag / Fusion Protein
    • 3xFLAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MfeI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer CGAGGTCGACGGTATCG
  • 3′ sequencing primer CAAGTTAACAACAACAATTGCATTCATTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p2T-CAG-SpCas9-BlastR was a gift from Richard Sherwood (Addgene plasmid # 107190 ; http://n2t.net/addgene:107190 ; RRID:Addgene_107190)
  • For your References section:

    Predictable and precise template-free CRISPR editing of pathogenic variants. Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI. Nature. 2018 Nov;563(7733):646-651. doi: 10.1038/s41586-018-0686-x. Epub 2018 Nov 7. 10.1038/s41586-018-0686-x PubMed 30405244