Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTRE-T2-IRES-His6-Ubiquitin
(Plasmid #107107)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107107 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRE-T2-delta-miR-IRES
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4857
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human ubiquitin UBB
  • Alt name
    UBB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    258
  • GenBank ID
    Gene ID: 7314
  • Entrez Gene
    UBB (a.k.a. HEL-S-50)
  • Promoter Tet
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer IRES internal sequencing primer #1: GAAGCAGTTCCTCTGGAAGC and IRES internal sequencing primer #2: GTATGGGATCTGATCTGGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

XbaI site at 3' His6 Ubiquitin is methylation sensitive

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE-T2-IRES-His6-Ubiquitin was a gift from Michael E. Wright (Addgene plasmid # 107107 ; http://n2t.net/addgene:107107 ; RRID:Addgene_107107)