Skip to main content
Addgene

pMAL-SsoPCNA3
(Plasmid #107069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107069 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMAL-c5E
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 5670
  • Total vector size (bp) 6520
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Supplement with 1% glucose is recommended to suppress leaky expression.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    S. solfataricus PCNA3
  • Alt name
    SsoPCNA3
  • Species
    Synthetic; Sulfolobus solfataricus P2
  • Promoter tac promoter
  • Tags / Fusion Proteins
    • MBP (N terminal on backbone)
    • 6xHis-thrombin cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer MBP-F
  • 3′ sequencing primer TGTCCTACTCAGGAGAGCGTTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAL-SsoPCNA3 was a gift from Teruyuki Nagamune (Addgene plasmid # 107069 ; http://n2t.net/addgene:107069 ; RRID:Addgene_107069)
  • For your References section:

    Three proliferating cell nuclear antigen homologues from Metallosphaera sedula form a head-to-tail heterotrimer. Iwata F, Hirakawa H, Nagamune T. Sci Rep. 2016 May 27;6:26588. doi: 10.1038/srep26588. 10.1038/srep26588 PubMed 27228945