Skip to main content
Addgene

pUDP046
(Plasmid #107062)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107062 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUDP002 #103872
  • Backbone manufacturer
    Juergens H et al. Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA expression plasmid
  • Backbone size w/o insert (bp) 10046
  • Total vector size (bp) 10237
  • Vector type
    Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
  • gRNA/shRNA sequence
    CATCGTTCTGCAGAAGATCATGG
  • Species
    Ogataea parapolymorpha
  • GenBank ID
    XM_014081660
  • Promoter ScTDH3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer ACATCGTAGGTGTCTGGGTGAAC
  • 3′ sequencing primer CTTTTCGGTTAGAGCGGATGTGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUDP046 was a gift from Jean-Marc Daran (Addgene plasmid # 107062 ; http://n2t.net/addgene:107062 ; RRID:Addgene_107062)

  • For your References section:

    Genome editing in Kluyveromyces and Ogataea yeasts using a broad-host-range Cas9/gRNA co-expression plasmid. Juergens H, Varela JA, Gorter de Vries AR, Perli T, Gast VJM, Gyurchev NY, Rajkumar AS, Mans R, Pronk JT, Morrissey JP, Daran JG. FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012. 10.1093/femsyr/foy012 PubMed 29438517
Related items: