K785R Smarca4-sfGFP
(Plasmid #107057)

• Purpose: Expression of dominant-negative K785R Smarca4 (Brg1) with C-terminal super-folder GFP fusion.
• Depositing Labs: Jerry Crabtree, Courtney Hodges
• Publication: Hodges et al Nat Struct Mol Biol. 2018 Jan;25(1):61-72. doi: 10.1038/s41594-017-0007-3. Epub 2017 Dec 11.

Backbone

• Vector backbone: pRRL
• Total vector size (bp): 13444
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
• Species: M. musculus (mouse)
• Mutation: K785R
• Entrez Gene: Smarca4 (a.k.a. BAF190A, Brg1, HP1-BP72, SNF2beta, SW1/SNF, b2b508.1Clo, b2b692Clo)
• Promoter: CAG
• Tag / Fusion Protein:
  • Super-folder GFP (sfGFP) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GGTTCGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry