pGC684
(Plasmid
#107022)
-
PurposeGFP reporter of lag-2 driven by 1 kb of promoter, which lackes both DBS and Cons motifs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ151
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-PH
-
SpeciesC. elegans (nematode)
- Promoter lag-2
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taaattagttttcgaattcccgc
- 3′ sequencing primer ttaTTTGTATAGTTCATCCATGCCATGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGC684 was a gift from Jane Hubbard (Addgene plasmid # 107022 ; http://n2t.net/addgene:107022 ; RRID:Addgene_107022) -
For your References section:
Linking the environment, DAF-7/TGFbeta signaling and LAG-2/DSL ligand expression in the germline stem cell niche. Pekar O, Ow MC, Hui KY, Noyes MB, Hall SE, Hubbard EJA. Development. 2017 Aug 15;144(16):2896-2906. doi: 10.1242/dev.147660. 10.1242/dev.147660 PubMed 28811311