-
PurposeExpresses murine PD-L1 with the 3'UTR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUNO
-
Backbone manufacturerInVivoGen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCD274
-
Alt namePD-L1, B7-H1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3556
-
Entrez GeneCd274 (a.k.a. A530045L16Rik, B7h1, Pdcd1l1, Pdcd1lg1, Pdl1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer EBV-RP: GTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUNO mouse CD274 + 3'UTR WT full length was a gift from Julian Downward (Addgene plasmid # 107012 ; http://n2t.net/addgene:107012 ; RRID:Addgene_107012) -
For your References section:
Oncogenic RAS Signaling Promotes Tumor Immunoresistance by Stabilizing PD-L1 mRNA. Coelho MA, de Carne Trecesson S, Rana S, Zecchin D, Moore C, Molina-Arcas M, East P, Spencer-Dene B, Nye E, Barnouin K, Snijders AP, Lai WS, Blackshear PJ, Downward J. Immunity. 2017 Dec 19;47(6):1083-1099.e6. doi: 10.1016/j.immuni.2017.11.016. Epub 2017 Dec 12. 10.1016/j.immuni.2017.11.016 PubMed 29246442