CROPseq-EFS-HypaSpCas9-P2A-puro
(Plasmid #106965)

• Purpose: single-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screen
• Depositing Lab: Alex Hewitt
• Publication: CROPseq plasmids (unpublished)

Backbone

• Vector backbone: CROPseq-Guide-EFS-SpCas9-P2A-puro
• Backbone size w/o insert (bp): 5280
• Total vector size (bp): 13704
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HypaSpCas9
• Species: Synthetic; Streptococcus pyogenes
• Insert Size (bp): 4212
• Promoter: EFS

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACGGGTTTGCCGCCAGAACA

Resource Information

• Supplemental Documents:
  • gibass-cropseq-pefs-hypaspcas9-p2a-puro.gb
• A portion of this plasmid was derived from a plasmid made by: HypaSpCas9 cloned from BPK4410 plasmid (Addgene#101178) from Jennifer Doudna and Keith Joung labs. CROPseq-Guide-EFS-SpCas9-P2A-Puro backbone used to make this construct was originally derived from the CROPseq-Guide-Puro (Addgene#86708) from Christoph Bock Lab.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry